tet plko neo vector (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
tet plko neo vector
Tet Plko Neo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+neo+vector/Tet-pLKO-neo+(Plasmid+%2321916)/pm38943644-188-9-11
Average 94 stars, based on 63 article reviews
Tet Plko Neo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+neo+vector/Tet-pLKO-neo+(Plasmid+%2321916)/pm38943644-188-9-11
Average 94 stars, based on 63 article reviews
tet plko neo vector - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Cloning:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Sequencing:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Plasmid Preparation:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing apoptosis mediated by CDC73 and p53 Article Snippet: .. To construct the pLKO-Tet-shCdc73 plasmid, Cdc73-shRNA (mCdc73-shRNA: CTCGTTTGGAAGGCCATAAAG) was inserted into the Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing CDC73 and p53 mediated apoptosis. Article Snippet: .. To construct pLKO-Tet-shUbr5, pLKO-tet-scrambled and pLKO-TetshCdc73 plasmids, Ubr5-shRNA (sequences are listed in Table S1) and scrambled shRNA Cdc73-shRNA were cloned into the Tet-pLKO-puro (Addgene, plasmid # 21915) and Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: Translocational attenuation mediated by the PERK-SRP14 axis is a protective mechanism of unfolded protein response. Article Snippet: .. The annealed shNC and shHRD1 oligonucleotides were ligated into Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases mediated by CDC73 and p53 Article Snippet: .. To construct the pLKO-Tet-shCdc73 plasmid, Cdc73-shRNA (mCdc73-shRNA: CTCGTTTGGAAGGCCATAAAG) was inserted into the Article Title: NBS1-CtIP–mediated DNA end resection suppresses cGAS binding to micronuclei Article Snippet: Panels of human cGAS-specific shRNAs (TRCN0000128706, TRCN0000128310, TRCN0000149984, TRCN0000146282 and TRCN0000150010), human NBS1-specific shRNAs (TRCN0000295898, TRCN0000040137, TRCN0000040133, TRCN0000012671 and TRCN0000012672), human CtIP-specific shRNAs (Sigma, TRCN0000318738, TRCN0000005403, and TRCN0000005405) and human RNF20-specific shRNAs (Sigma, TRCN0000033876, TRCN0000033877 and TRCN0000033878) were purchased from Sigma. .. To make tetracycline-inducible shNBS1 RNA constructs, we annealed shNBS1-F1/F2/F3 and shNBS1-R1/R2/R3 primers ( ) in annealing buffer (100 mM NaCl, 10 mM Tris–HCl, pH 7.4), then ligated them into AgeI-EcoRI sites of a Clone Assay:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing CDC73 and p53 mediated apoptosis. Article Snippet: .. To construct pLKO-Tet-shUbr5, pLKO-tet-scrambled and pLKO-TetshCdc73 plasmids, Ubr5-shRNA (sequences are listed in Table S1) and scrambled shRNA Cdc73-shRNA were cloned into the Tet-pLKO-puro (Addgene, plasmid # 21915) and Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Mutagenesis:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Transfection:Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts. Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into Construct:Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing apoptosis mediated by CDC73 and p53 Article Snippet: .. To construct the pLKO-Tet-shCdc73 plasmid, Cdc73-shRNA (mCdc73-shRNA: CTCGTTTGGAAGGCCATAAAG) was inserted into the Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing CDC73 and p53 mediated apoptosis. Article Snippet: .. To construct pLKO-Tet-shUbr5, pLKO-tet-scrambled and pLKO-TetshCdc73 plasmids, Ubr5-shRNA (sequences are listed in Table S1) and scrambled shRNA Cdc73-shRNA were cloned into the Tet-pLKO-puro (Addgene, plasmid # 21915) and Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases mediated by CDC73 and p53 Article Snippet: .. To construct the pLKO-Tet-shCdc73 plasmid, Cdc73-shRNA (mCdc73-shRNA: CTCGTTTGGAAGGCCATAAAG) was inserted into the Article Title: NBS1-CtIP–mediated DNA end resection suppresses cGAS binding to micronuclei Article Snippet: Panels of human cGAS-specific shRNAs (TRCN0000128706, TRCN0000128310, TRCN0000149984, TRCN0000146282 and TRCN0000150010), human NBS1-specific shRNAs (TRCN0000295898, TRCN0000040137, TRCN0000040133, TRCN0000012671 and TRCN0000012672), human CtIP-specific shRNAs (Sigma, TRCN0000318738, TRCN0000005403, and TRCN0000005405) and human RNF20-specific shRNAs (Sigma, TRCN0000033876, TRCN0000033877 and TRCN0000033878) were purchased from Sigma. .. To make tetracycline-inducible shNBS1 RNA constructs, we annealed shNBS1-F1/F2/F3 and shNBS1-R1/R2/R3 primers ( ) in annealing buffer (100 mM NaCl, 10 mM Tris–HCl, pH 7.4), then ligated them into AgeI-EcoRI sites of a shRNA:Article Title: Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing CDC73 and p53 mediated apoptosis. Article Snippet: .. To construct pLKO-Tet-shUbr5, pLKO-tet-scrambled and pLKO-TetshCdc73 plasmids, Ubr5-shRNA (sequences are listed in Table S1) and scrambled shRNA Cdc73-shRNA were cloned into the Tet-pLKO-puro (Addgene, plasmid # 21915) and Article Title: The Human Integrator Complex Facilitates Transcriptional Elongation by Endonucleolytic Cleavage of Nascent Transcripts Article Snippet: .. HeLa rescue cells were established by cloning the same shINTS11 sequence into |
